Library

Demo construct

Synthetic circular demonstration construct. The CDS encodes the made-up peptide MAEELKGENHELIDEMAPEPTIDE. The promoter landmark is the published T7 consensus. This is not a natural plasmid and not a cloning recipe.

214 bp47.2% GCcircularReady

3D sequence

Fiber draws the duplex the way a stained molecule reads under a microscope: two continuous backbones and base-pair rungs. 10.5 bp per turn. Position 1 is marked. Each rung is one base pair. The outer ribbon is GC, arcs are annotations, inner lines are open reading frames, and amber marks are restriction sites. This is a drawing of the string, not an atomic model.

Testdemo_construct214 bpcircular

Search runs on this sequence, including across the origin when the molecule is circular.

1GCTAGCGAATTCGGTACCACGTACGTACGTACGATCGTACGTACGTACGTACGTAAACCC
61GGGTTTGCTAGCTAATACGACTCACTATAGGAAATTTGCAGGAGGACATAAATGGCGGAA
121GAGCTGAAGGGCGAAAACCACGAGTTGATCGACGAAATGGCCCCGGAACCGACCATCGAC
181GAATAATTTTTGGATCCAAAAAAAAGCATGCTTT
ATGCCoordinates on each line are 1-based.

Digest, guides, primers, codon choice, assembly, and the population path all use this project. Pass a result and the map, the working sequence, and Compare pick it up.

Restriction digest

267 enzymes from TeselaGen sequence-utils. Overlap with GATC or CCWGG is flagged. That is a sequence fact, not a prediction that the enzyme is blocked.

  • EcoRI · forward7–12 · overhang AATT
  • BamHI · forward · overlaps GATC192–197 · overhang GATC

Fragments

  • 185 bpEcoRIBamHI · 8192
  • 29 bpBamHIEcoRI · 1937