Library

Thalasemia

Thalasemia

28 bp35.7% GClinearReady

3D sequence

Fiber draws the duplex the way a stained molecule reads under a microscope: two continuous backbones and base-pair rungs. 10.5 bp per turn. Position 1 is marked. Each rung is one base pair. The outer ribbon is GC, arcs are annotations, inner lines are open reading frames, and amber marks are restriction sites. This is a drawing of the string, not an atomic model.

Testhg38_dna_var_HBB_Thalassemia_TestCase_0128 bplinear drawing

Search runs on this sequence, including across the origin when the molecule is circular.

1TTTTATGCGATCGATCGATCGATCAAAA
ATGCCoordinates on each line are 1-based.

Digest, guides, primers, codon choice, assembly, and the population path all use this project. Pass a result and the map, the working sequence, and Compare pick it up.

Restriction digest

267 enzymes from TeselaGen sequence-utils. Overlap with GATC or CCWGG is flagged. That is a sequence fact, not a prediction that the enzyme is blocked.

  • No cuts for the selected enzymes.

Fragments

    Thalasemia · GenoM