28 bp35.7% GClinearReady
3D sequence
Fiber draws the duplex the way a stained molecule reads under a microscope: two continuous backbones and base-pair rungs. 10.5 bp per turn. Position 1 is marked. Each rung is one base pair. The outer ribbon is GC, arcs are annotations, inner lines are open reading frames, and amber marks are restriction sites. This is a drawing of the string, not an atomic model.
Search runs on this sequence, including across the origin when the molecule is circular.
1TTTTATGCGATCGATCGATCGATCAAAA
ATGCCoordinates on each line are 1-based.
Digest, guides, primers, codon choice, assembly, and the population path all use this project. Pass a result and the map, the working sequence, and Compare pick it up.
Assembly
Gibson joins an exact 15–40 bp overlap and reports its SantaLucia Tm. The overlap is written once in the product.