Library

Thalasemia Gibson

Assembly product from Thalasemia.

28 bp35.7% GClinearReady

3D sequence

Fiber draws the duplex the way a stained molecule reads under a microscope: two continuous backbones and base-pair rungs. 10.5 bp per turn. Position 1 is marked. Each rung is one base pair. The outer ribbon is GC, arcs are annotations, inner lines are open reading frames, and amber marks are restriction sites. This is a drawing of the string, not an atomic model.

sequence28 bplinear drawing

Search runs on this sequence, including across the origin when the molecule is circular.

1TTTTATGCGATCGATCGATCGATCAAAA
ATGCCoordinates on each line are 1-based.

Digest, guides, primers, codon choice, assembly, and the population path all use this project. Pass a result and the map, the working sequence, and Compare pick it up.

Guide RNA scan

Spacers are taken beside the PAM, as in crisprDesign. The score is a GC and homopolymer filter. Similar sites are counted only inside this sequence, not against a reference genome.

    No complete spacer-PAM sites in this sequence.

    Thalasemia Gibson · GenoM