Library

Thalasemia Gibson

Assembly product from Thalasemia.

28 bp35.7% GClinearReady

3D sequence

Fiber draws the duplex the way a stained molecule reads under a microscope: two continuous backbones and base-pair rungs. 10.5 bp per turn. Position 1 is marked. Each rung is one base pair. The outer ribbon is GC, arcs are annotations, inner lines are open reading frames, and amber marks are restriction sites. This is a drawing of the string, not an atomic model.

sequence28 bplinear drawing

Search runs on this sequence, including across the origin when the molecule is circular.

1TTTTATGCGATCGATCGATCGATCAAAA
ATGCCoordinates on each line are 1-based.

Digest, guides, primers, codon choice, assembly, and the population path all use this project. Pass a result and the map, the working sequence, and Compare pick it up.

Wright–Fisher frequency

Haploid selection, then binomial resampling. This is the textbook model inside forward simulators such as SLiM’s Wright–Fisher mode. It is not a SLiM or msprime run.

Start 0.100 · end 0.830

Edit outcome estimate

Shares of unedited, knock-in, and indel cells from a cut rate and an HDR fraction. This is a planning estimate, not ICE or TIDE.

Unedited 30.0 · knock-in 21.0 · indel 49.0